/* A program for global alignment with a context-dependent scoring scheme

     copyright (c) 1995	Xiaoqiu Huang 
     The distribution of the program is granted provided no charge is made
     and the copyright notice is included.
     E-mail: huang@cs.mtu.edu

     Proper attribution of the author as the source of the software would
     be appreciated:
     A Context Dependent Method for Comparing Sequences,
     Proceedings of the 5th Symposium on Combinatorial Pattern Matching,
     Lecture Notes in Computer Science 807, Springer-Verlag, 54-63.
	      Xiaoqiu Huang
	      Department of Computer Science
	      Michigan Technological University
	      Houghton, MI 49931

    The Context-Dependent Alignment (CDA) program computes a global alignment
    of two sequences. It delivers the alignment in linear space,
    so long sequences can be aligned. 

    Users supply scoring parameters. In the simplest form, users just
    provide 5 integers: ms, q, r, l and b, where ms is the score of a mismatch,
    q is gap-open penalty, r is gap-extension penalty, l is context length,
    and b is match bonus. Each match automatically receives a score of 10. 
    The score of an i-symbol indel is -(q + r * i). A match in a substitution
    block receives a single left bonus of b if at least one other match occurs
    within l positions to the left of the match. Similarly, a match in a
    substitution block receives a single right bonus of b if at least one other
    match occurs within l positions to the right of the match.
    This simple scoring scheme may be used for DNA sequences.
    NOTE: all scores are integers.

    In general, users can define an alphabet of characters appearing in the
    sequences and a matrix that gives the context-independent substitution
    score for each pair of symbols in the alphabet.  The 127 ASCII characters
    are eligible. The alphabet and matrix are given in a file, where the first
    line lists the characters in the alphabet and the lower triangle of the
    matrix comes next. An example file looks as follows:

    ARNDC	       
     13
    -15  19
    -10 -22  11
    -20 -10 -20  18
    -10 -20 -10 -20  12

    Here the -22 at position (3,2) is the score of replacing N by R.
    This general scoring scheme is useful for protein sequences where the
    set of protein characters and Dayhoff matrix are specified in the file.

    The CDA program is written in C and runs under Unix systems on
    Sun workstations and under DOS systems on PCs.
    We think that the program is portable to many machines.

    Sequences to be analyzed are stored in separate files.
    An input file contains all characters of a sequence, separated by
    newline characters, in linear order. No other characters are allowed.
    Since upper case and lower case characters are different, use the same
    case consistently. A sample sequence file of 4 lines is shown below.

GAATTCTAATCTCCCTCTCAACCCTACAGTCACCCATTTGGTATATTAAA
GATGTGTTGTCTACTGTCTAGTATCCCTCAAGTAGTGTCAGGAATTAGTC
ATTTAAATAGTCTGCAAGCCAGGAGTGGTGGCTCATGTCTGTAATTCCAG
CACTGGAGAGGTAGAAGTG

    To find the best alignment of two sequences in files A and B,
    use a command of form

	   cda  A  B  ms  q  r  l  b > result

    where cda is the name of the object code, ms is a negative integer
    specifying mismatch weight, q and r are non-negative integers specifying
    gap-open and gap-extend penalties, respectively, l is a positive integer
    giving context length, and b is a non-negative integer giving match bonus.
    Output alignment is saved in the file "result".

    For using a scoring matrix defined in file S, use a command of form

	   cda  A  B  S  q  r l b > result

    Note that ms is replaced by the file S.

    Acknowledgments
    The functions diff() and display() are from Gene Myers. We made
    the following modifications: similarity weights (integer), instead of
    distance weights (float), are used. A context-dependent scoring scheme
    is used for close matches.
*/

#include   <stdio.h>

static int match, mismh;		/* max and min substitution weights */
static char *name1, *name2;		/* names of sequence files    */
static int v[128][128];			/* substitution scores */
static int w[128][128];			/* context-denpendent substitution scores */
static int MatchDis;			/* maximum distance between two adjacent matches */

static int q, r;			/* gap penalties */
static int qr;				/* qr = q + r */

static int *CC, *DD;			/* saving matrix scores */
static int *RR, *SS, *EE, *FF; 		/* saving start-points */
static int *HH, *WW;		 	/* saving matrix scores */
static int *II, *JJ, *XX, *YY; 		/* saving start-points */
static int *GG, *QQ;			/* context-dependent matrix scores */
static int *FL, *BL;			/* distance of the last match */
static int *S;

static int *sapp;				/* Current script append ptr */
static int  last;				/* Last script op appended */

static int no_mat; 				/* number of matches */ 
static int no_mis; 				/* number of mismatches */ 
static int al_len; 				/* length of alignment */

main(argc, argv) int argc; char *argv[];
{ int  M, N;			/* Sequence lengths and k     */
  char  *A,  *B;			/* Storing two sequences      */
  int  symbol;				/* The next character         */
  int  score;
  int  ms;				/* User-supplied weights      */
  FILE *Bp, *Ap, *Sp, *ckopen();
  char *ckalloc();			/* space-allocating function  */
  register int i, j;
  char  alph[129], *s;			/* alphabet */
  int  size, t;			/* size of alphabet */
  int  bonus;		/* match bonus */

	if ( argc != 8 )
	   fatalf("The proper form of command is: \n%s file1 file2 mismatch(<0) gap-open(>=0) gap-extend(>0) context-length(>0) match-bonus(>=0)", argv[0]);

	/* determine the sequence lengths */
	Ap = ckopen(argv[1], "r");
	for (M = 0; ( symbol = getc(Ap)) != EOF ; )
	   if ( symbol != '\n' )
	      ++M;
	(void) fclose(Ap);
	name1 = argv[1];

	/* allocate space for A */
	A = ( char * ) ckalloc( (M + 1) * sizeof(char));

	/* read the first sequence into A */
	Ap = ckopen(argv[1], "r");
	for (M = 0; ( symbol = getc(Ap)) != EOF ; )
	   if ( symbol != '\n' )
		A[++M] = symbol;

	/* if there is another sequence, read it into B */
	if ( argc == 8 )
	  { Bp = ckopen(argv[2], "r");
	    for (N = 0; ( symbol = getc(Bp)) != EOF ; )
	       if ( symbol != '\n' )
	          ++N;
	    (void) fclose(Bp);
	    name2 = argv[2];
	    B = ( char * ) ckalloc( (N + 1) * sizeof(char));
	    Bp = ckopen(argv[2], "r");
	    for (N = 0; ( symbol = getc(Bp)) != EOF ; )
	       if ( symbol != '\n' )
	            B[++N] = symbol;
	  }

	(void) sscanf(argv[argc-4],"%d", &q);
	if ( q < 0 )
	   fatal("The gap-open penalty is a nonnegative integer");

	(void) sscanf(argv[argc-3],"%d", &r);
	if ( r <= 0 )
	   fatal("The gap-extend penalty is a positive integer");
	qr = q + r;
	/* check if the argument represents a negative integer */
	s = argv[argc-5];
	if ( *s == '-' ) s++;
	for ( ; *s >= '0' && *s <= '9' ; s++ );
	if ( *s == '\0' )
	  { (void) sscanf(argv[argc-5],"%d", &ms);
	    if ( ms >= 0 )
	       fatal("The mismatch weight is a negative integer");
	    match = 10;
	    mismh = ms;
	    /* set match and mismatch weights */
	    for ( i = 0; i < 128 ; i++ )
	      for ( j = 0; j < 128 ; j++ )
	         if (i == j )
	            v[i][j] = 10;
	         else
	            v[i][j] = mismh;
	  }
	else
	  { /* read a file containing alphabet and substitution weights */
	    Sp = ckopen(argv[argc-5], "r");
	    (void) fscanf(Sp, "%s", alph);
	    size = strlen(alph);
	    match = mismh = 0;
	    for ( i = 0; i < size ; i++ )
	      for ( j = 0; j <= i ; j++ )
		{ (void) fscanf(Sp, "%d", &ms);
		  v[alph[i]][alph[j]] = v[alph[j]][alph[i]] = ms;
		  if ( ms > match ) match = ms;
		  if ( ms < mismh ) mismh = ms;
		}
	  }
	(void) sscanf(argv[argc-2],"%d", &MatchDis);
	if ( MatchDis <= 0 )
	   fatal("The context length is a positive integer");
	(void) sscanf(argv[argc-1],"%d", &bonus);
	if ( bonus < 0 )
	   fatal("The match bonus a nonnegative integer");
	for ( i = 0; i < 128 ; i++ )
	  for ( j = 0; j < 128 ; j++ )
	     if (i == j )
	        w[i][j] = bonus;
	     else
	        w[i][j] = 0;

	/* allocate space for all vectors */
	j = (N + 1) * sizeof(int);
	CC = ( int * ) ckalloc(j);
	DD = ( int * ) ckalloc(j);
	RR = ( int * ) ckalloc(j);
	SS = ( int * ) ckalloc(j);
	EE = ( int * ) ckalloc(j);
	FF = ( int * ) ckalloc(j);
	GG = ( int * ) ckalloc(j);
	QQ = ( int * ) ckalloc(j);
	FL = ( int * ) ckalloc(j);
	BL = ( int * ) ckalloc(j);
	i = (M + 1) * sizeof(int);
	HH = ( int * ) ckalloc(i);
	WW = ( int * ) ckalloc(i);
	II = ( int * ) ckalloc(i);
	JJ = ( int * ) ckalloc(i);
	XX = ( int * ) ckalloc(i);
	YY = ( int * ) ckalloc(i);
	S = ( int * ) ckalloc(i + j);
	printf("Match  Mismatch  Gap-Open Penalty  Gap-Extension Penalty  Context-Length  Bonus\n");
       printf(" %d      %d           %d                 %d                     %d           %d\n\n",
			match, mismh, q, r, MatchDis, bonus);
	  { printf("                 Upper Sequence : %s\n", name1);
	    printf("                         Length : %d\n", M);
	    printf("                 Lower Sequence : %s\n", name2);
	    printf("                         Length : %d\n", N);
	  }
            sapp = S;
            last = 0;
            al_len = 0;
            no_mat = 0;
	    no_mis = 0;
            score = diff(A, B,M,N,q,q,0,0);
            /* Output the best alignment */
            printf("      Similarity Score : %d\n",score);
            printf("      Match Percentage : %d%%\n", (100*no_mat)/al_len);
            printf("      Number of Matches : %d\n", no_mat);
            printf("      Number of Mismatches : %d\n", no_mis);
            printf("      Total Length of Gaps : %d\n", al_len-no_mat-no_mis);
            display(A,B,M,N,S,1,1);
	    fflush(stdout);
}

int  diff(), display();

#define gap(k)  ((k) <= 0 ? 0 : q+r*(k))	/* k-symbol indel score */

						/* Append "Delete k" op */
#define DEL(k)				\
{ al_len += k;				\
  if (last < 0)				\
    last = sapp[-1] -= (k);		\
  else					\
    last = *sapp++ = -(k);		\
}
						/* Append "Insert k" op */
#define INS(k)				\
{ al_len += k;				\
  if (last < 0)				\
    { sapp[-1] = (k); *sapp++ = last; }	\
  else					\
    last = *sapp++ = (k);		\
}
						/* Append "Replace" op */
#define REP 				\
{ last = *sapp++ = 0; 			\
  al_len += 1;				\
}

/* diff(A,B,M,N,tb,te,db,de) returns the score of an optimum conversion between
   A[1..M] and B[1..N] and appends such a conversion to the current script.
   The conversion begins (ends) with a delete if tb (te) is zero, or
   it begins (ends) with a replacement if db (de) is positive.                  */

int diff(A,B,M,N,tb,te,db,de) char *A, *B; int M, N; int tb, te, db, de;

{ int   midi, midj, type;	/* Midpoint, type, and cost */
  int midc;

  register int   i, j;
  register int c, e, d, s;
	   int f, g, cl, sl;
           int t, *va, *wa;
	   int ai, bj;
  	   char  *ckalloc();

/* Boundary cases: M <= 1 or N == 0 */

  if (N <= 0)
    { if (M > 0) DEL(M)
      return - gap(M);
    }
  if (M <= 1)
    { if (M <= 0)
        { INS(N);
          return - gap(N);
        }
      if (tb > te) tb = te;
      midc = - (tb + r + gap(N) );
      midj = 0;
      va = v[A[1]];
      for (j = 1; j <= N; j++)
            { c = va[B[j]] - ( gap(j-1) + gap(N-j) );
	      if ( j == 1 ) c += db;
	      if ( j == N ) c += de;
              if (c > midc)
               { midc = c;
                 midj = j;
               }
	    }
      if (midj == 0)
        { INS(N) DEL(1) }
      else
        { if (midj > 1) INS(midj-1)
          REP
	  if ( A[1] == B[midj] )
	     no_mat += 1;
	  else
	     no_mis += 1;
          if (midj < N) INS(N-midj)
        }
      return midc;
    }

/* Divide: Find optimum midpoint (midi,midj) of cost midc */

  midi = M/2;			/* Forward phase:                          */
  CC[0] = 0;			/*   Compute C(M/2,k) & D(M/2,k) for all k */
  t = -q;
  for (j = 1; j <= N; j++)
    { CC[j] = GG[j] = t = t-r;
      DD[j] = t-q;
      FL[j] = MatchDis + 1;
    }
  t = -tb;
  for (i = 1; i <= midi; i++)
    { s = CC[0];
      f = i == 1 ? db : s;
      CC[0] = c = t = t-r;
      sl = MatchDis + 1;
      e = t-q;
      va = v[(ai = A[i])];
      wa = w[ai];
      for (j = 1; j <= N; j++)
        { if ((c = c - qr) > (e = e - r)) e = c;
          if ((c = CC[j] - qr) > (d = DD[j] - r)) d = c;
	  g = va[(bj = B[j])];
	  c = s+g;
	  g += f;
	  if ( ai != bj )
	   cl = sl + 1;
	  else
	   { if ( sl <= MatchDis )
	       g += wa[bj] + w[A[i-sl]][B[j-sl]];
	     if ( g < c )
	       g = c;
	     cl = 1;
	   }
          if (c < d) c = d;
          if (c < e) c = e;
	  if (c < g) c = g;
          s = CC[j];
          CC[j] = c;
          DD[j] = d;
	  sl = FL[j];
	  FL[j] = cl;
	  f = GG[j];
	  GG[j] = g;
        }
    }
  DD[0] = CC[0];

  RR[N] = 0;			/* Reverse phase:                          */
  t = -q;			/*   Compute R(M/2,k) & S(M/2,k) for all k */
  for (j = N-1; j >= 0; j--)
    { RR[j] = QQ[j] = t = t-r;
      SS[j] = t-q;
      BL[j] = MatchDis + 1;
    }
  t = -te;
  for (i = M-1; i >= midi; i--)
    { s = RR[N];
      f = (i == M-1) ? de : s;
      RR[N] = c = t = t-r;
      sl = MatchDis + 1;
      e = t-q;
      va = v[(ai = A[i+1])];
      wa = w[ai];
      for (j = N-1; j >= 0; j--)
        { if ((c = c - qr) > (e = e - r)) e = c;
          if ((c = RR[j] - qr) > (d = SS[j] - r)) d = c;
	  g = va[(bj = B[j+1])];
	  c = s+g;
	  g += f;
	  if ( ai != bj )
	   cl = sl + 1;
	  else
	   { if ( sl <= MatchDis )
	       g += wa[bj] + w[A[i+1+sl]][B[j+1+sl]];
	     if ( g < c )
	       g = c;
	     cl = 1;
	   }
          if (c < d) c = d;
          if (c < e) c = e;
	  if (c < g) c = g;
          s = RR[j];
          RR[j] = c;
          SS[j] = d;
	  sl = BL[j];
	  BL[j] = cl;
	  f = QQ[j];
	  QQ[j] = g;
        }
    }
  SS[N] = RR[N];

  midc = CC[0]+RR[0];		/* Find optimal midpoint */
  midj = 0;
  type = 1;
  for (j = 0; j <= N; j++)
    if ((c = CC[j] + RR[j]) >= midc)
      if (c > midc || CC[j] != DD[j] && RR[j] == SS[j])
        { midc = c;
          midj = j;
        }
  for (j = N; j >= 0; j--)
    if ((c = DD[j] + SS[j] + q) > midc)
      { midc = c;
        midj = j;
        type = 2;
      }
  for (j = N-1; j > 0; j--)
    if ( FL[j] + BL[j] - 1 <= MatchDis )
     { f = w[A[midi-FL[j]+1]][B[j-FL[j]+1]] + w[A[midi+BL[j]]][B[j+BL[j]]];
       if ( ( c = GG[j] + QQ[j] + f ) > midc )
	{ midc = c;
	  midj = j;
	  type = 3;
	  g = f;
	  cl = FL[j] - 1;
	  sl = BL[j] - 1;
	}
     }

/* Conquer: recursively around midpoint */

  if (type == 1)
    { diff(A,B,midi,midj,tb,q,db,0);
      diff(A+midi,B+midj,M-midi,N-midj,q,te,0,de);
    }
  else
   if ( type == 2)
    { diff(A,B,midi-1,midj,tb,0,db,0);
      DEL(2);
      diff(A+midi+1,B+midj,M-midi-1,N-midj,0,te,0,de);
    }
   else
    { diff(A,B,midi-cl,midj-cl,tb,q,db,g);
      for ( i = 1; i <= cl + sl; i++ )
       { REP
	 if ( A[midi-cl+i] == B[midj-cl+i] )
	     no_mat += 1;
	 else
	     no_mis += 1;
       }
      diff(A+midi+sl,B+midj+sl,M-midi-sl,N-midj-sl,q,te,g,de);
    }
  return midc;
}

/* Alignment display routine */

static char ALINE[51], BLINE[51], CLINE[51];

int display(A,B,M,N,S,AP,BP) char A[], B[]; int M, N; int S[], AP, BP;
{ register char *a, *b, *c;
  register int   i,  j, op;
           int   lines, ap, bp;

  i = j = op = lines = 0;
  ap = AP;
  bp = BP;
  a = ALINE;
  b = BLINE;
  c = CLINE;
  while (i < M || j < N)
    { if (op == 0 && *S == 0)
        { op = *S++;
          *a = A[++i];
          *b = B[++j];
          *c++ = (*a++ == *b++) ? '|' : ' ';
        }
      else
        { if (op == 0)
            op = *S++;
          if (op > 0)
            { *a++ = ' ';
              *b++ = B[++j];
              op--;
            }
          else
            { *a++ = A[++i];
              *b++ = ' ';
              op++;
            }
          *c++ = '-';
        }
      if (a >= ALINE+50 || i >= M && j >= N)
        { *a = *b = *c = '\0';
          printf("\n%5d ",50*lines++);
          for (b = ALINE+10; b <= a; b += 10)
            printf("    .    :");
          if (b <= a+5)
            printf("    .");
          printf("\n%5d %s\n      %s\n%5d %s\n",ap,ALINE,CLINE,bp,BLINE);
	  ap = AP + i;
	  bp = BP + j;
          a = ALINE;
          b = BLINE;
          c = CLINE;
        }
    }
}

/* lib.c - library of C procedures. */

/* fatal - print message and die */
fatal(msg)
char *msg;
{
	fprintf(stderr, "%s\n", msg);
	exit(1);
}

/* fatalf - format message, print it, and die */
fatalf(msg, val)
char *msg, *val;
{
	fprintf(stderr, msg, val);
	putc('\n', stderr);
	exit(1);
}
	
/* ckopen - open file; check for success */
FILE *ckopen(name, mode)
char *name, *mode;
{
	FILE *fopen(), *fp;

	if ((fp = fopen(name, mode)) == NULL)
		fatalf("Cannot open %s.", name);
	return(fp);
}

/* ckalloc - allocate space; check for success */
char *ckalloc(amount)
int amount;
{
	char *malloc(), *p;

	if ((p = malloc( (unsigned) amount)) == NULL)
		fatal("Ran out of memory.");
	return(p);
}